Sanger

Sanger sequencing, the most widely used DNA sequencing method for the last 25 years or so, is based on the selective incorporation of chain-terminating dideoxynucleotides. The center offers Sanger for long contiguous DNA sequences (~900 nucleotides). We perform QC for all reactions before uploading the results.

 

Available Primers for Plasmids: 

Sequence Primer name
TAATACGACTCACTATAGGG T7
AATACGACTCACTATAG T7-short
GCTAGTTATTGCTCAGCGG T7-ter
ATTAACCCTCACTAAAGGGA T3
TATTTAGGTGACACTATAG SP6
TGTAAAACGACGGCCAGT (-20) M13 F
AACAGCTATGACCATGATTA (-20) M13 R
GTTTTCCCAGTGACGCA M13 (-40) F
CTAGCAAAATAGGCTGTCCC PGL F
GAAATACAAAAACCGCAGAAGG PGL R
ATTGACGCAAATGGGCGGTA CMV PRO
CCGGGAGCTGCATGTGTCAGAGG PGEX3 R

 

For data analysis we recommend to download the Sequence Scanner software for free. Import the ab1 files and view the electropherogram.

For sample and primer specification please read the instructions.

For new orders please go to BookitLab and follow the ‘create new order’ instructions.

For additional info, please contact Liat Linde, tel 04-8295452/221.